Immune response and asthma Essay

Role of Th2 T lymph cells

Th2 T lymph cells are sub group of lymph cells. After, Proliferation of T cells these develop into effecter T cells and differentiated into Th1 and Th2 cells. T cells bind to antigen presented by B cells and aid in bring oning B cells into proliferation and differentiate into B cell antibody category, antibody exchanging particularly IgA and IgE isotype. ( Figure1 ) . ( Epstein et.al.2006 ) .They plays a polar function in allergic unsusceptibility. The suppression of Th2 cells can take to change of balance between Th1 and Th2 unsusceptibility thereby doing autoimmunity. Th2 mediates humoral unsusceptibility and produces IL-4, IL-5, IL-6, IL-10, IL-13. ( slayer et.al.1987. , Mosmann et al.1986 )

Transcription factors GATA- 3 -controlling T cell coevals

GATA-3 is indispensable factor for T cell development and distinction. GATA-3 belongs to household of written text factor that binds to DNA sequence motive which is specific for Th2 written text factor. GATA-3 look is of import for CD4 Th2 cells as GATA-3 messenger RNA is expressed in low degree in naA?ve cell, it up regulates along Th2 line of descent and down regulates in Th1. ( Zhang et al.1997 ) .GATA-3 does non modulate IL-13 and IL-4 straight but considered to be chromatin reconstructing factor. ( Ray and cohn,1997 )

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

“ Adapted from Michelle M. Epstein et.al, ( 2006 ) Targeting memory Th2 cells for the intervention of allergic asthma, Pharmacology & A ; Therapeutics 109,107- 136 “ .

Allergic unsusceptibility triping the allergic asthma. A ) Allergens are uptaken by antigen showing cell in lungs. B ) It is in future processed into peptides that are composites with MHC class-II and are transported to cell surface. The interaction of complex with T cell receptor on naA?ve cell stimulation C ) Th2 distinction D ) Expansion of Th2 effecter and memory cells

IL-13 is cardinal medicate of asthma and helps in the effectual intervention which is done by neutralizing IL-13. These interlukins are effectual on B cells and monocytes but surveies conducted in carnal theoretical accounts reveled that it involved in antibody neutralisation and Acts of the Apostless as powerful adversary. It induces IGE production ( Wills-Karp et Al. 1998 ) .IL-13 look was found in allergen induced late nasal response ( Ghaffar O.et.al. 1997 ) . Increased IL-13 was look found in bronchial biopsies from atopic and atopic asthma. It is demonstrated that assorted signaling tracts are in ordinance of IL-13 synthesis in human T cells. ( Kotsimbos TC.et.al.1998 ) At nowadays there is wealth of research underway on word picture of IL-13 inhibitor to be exploited to happen a new drug for asthma.

Summarize what is known about a ) the mechanism by which IL-13 look is regulated and b ) functional polymorphism in the IL-13 cistron.

Regulation of IL-13 look:

Mechanism of look of IL-13 was regulated by assorted tracts such as Janus household Kinase and STAT6 pathway. The IL-13R is signaling human receptor which is hetero dimer. The IL-13R consists of interlukin-4 receptor concatenation an IL-4Ra and IL-13 binding concatenation. Association of IL-13 with its receptor STAT6 ( Signal transducter and activation of written text 6 ) and Janus household Kinase activation is induced due to interaction with IL-4Ra concatenation. ( Franklin J. Moy et. Al. 2001 ) .

IL-13 booster has GATA binding site and 2 GATA motifs.GATA- 3 is found to modulate the look of IL-13 and up modulate the look of Il-13 in transgenic mice theoretical account. ( Cecile Lavenu-Bombled et.al. 2002 ) .

Kiesler P.et Al ( 2009 ) , surveies demonstrates that Oct-1 binds to C allelomorphs at place -1512 of the IL13 booster and enhances IL-13 activity. In carnal theoretical account IL-13 look is controlled by Oct-1 degree in wild and mutated mice.

Functional Polymorphisms in the IL13 cistron

Research undergone by Arizone respiratory centre in hunt of SNP across venue of IL-13 showed seven polymorphism and two boosters are found in the 5 ‘ terminal of the cistron such as IL13-1512AC and IL13-1112CT.In 3’end of the cistron extends from IL13+1923CT in 3rd noncoding DNA to IL13+2749CT in 3 ‘ untranslated part. Enhancement of IL13 activity in the asthma was observed after permutation of glutamine by arginine at place 130. ( Donata Vercelli et.al 2002 )

Adapted from “ Donata Vercelli ( 2008 ) Detecting susceptibleness cistrons for asthma and allergy Nature Reviews Immunology 8, 169-182 ”

Familial fluctuation in Interleukin-13 venue was analyzed by SNP.A ) SNP block was formed to be present at 3 ‘ terminal of the cistron widening from IL13+1923CT in 3rd noncoding DNA to IL13+2749CT.B ) Illustrates SNP terminology in human and mice at that place was increased IL13 written text and mouse Th2 cells in IL13-11112CT/re180029.C ) Non synonymous SNP in 3’block IL13+2044GA consequences in IL13 Arg130Gln.D ) Seattle SNPs which provides ocular genotype. These are polymorphous site which has homozygous rare allelomorphs ( yellow ) , homozygous common allelomorph ( Grey ) , heterozygous both allelomorphs ( purple ) and genotype non determined.

To prove the functionality of the IL-13 HS4-1512C/A polymorphism in mouse Th2 and human T cells the writers made two type of concept. Describe these concept which allele at -1512C/A was more successful at heightening look of luciferase newsman, by how much, what controls were used?

2666IL13p/luc and HS4 luc Construct

Two newsmans construct such as 2666IL13p/luc and HS4 luc was employed to analyse the function of IL13 HS4 1512A/C polymorphism located in the distal booster part of IL13 cistron. Reporter concept 2666IL13p/luc was generated by executing Polymerase concatenation Reaction with genomic Deoxyribonucleic acid incurred from IL13-1512 discrepancy as a PCR templet. The concept was so cloned to pG13 basic luciferase vector ( Cameron, L. , et.al.2006 ) . pGL3 vector has good flexibleness in cloning regulative sequence as it lacks eucaryotic booster and regulative sequence. ( Figure:3 ) ( Schenborn, E. , et.al.1991 ) .site directed mutagenesis which wuickly changes the base brace was applied to bring forth luciferase newsman concept -2666IL13p-1512c/luc from -2666IL13p/luc concept driven by the with major IL13-1512A booster variant.HS6/luc comprising of a 363bp part which includes human IL13 proximal booster was incorporated into pG13 vector for cloning. ( Strempel, J.M.et.al.2007 )

Amplification of HS4 was performed utilizing templet such as -2666IL13p/luc or -2666IL13p-1512/luc and HS4-1650 ( 5′-ATACTCGTCGACATAAGGGGCGTTGACTCAC ) and HS4-1435 ( 5′-TTGATGTCGACTCTGACTCCCAGAAGTCTG ) primers. These amplicons are inserted into multiple cloning site of Sal I restriction site of HS6/luc which generates HS4-1512A/luc and HS4-1512C/luc.

“ Adapted from promega web site ”

Map of Vector pGL3-Basic vector: luc+CDNA which encods the modified fire beetle luciferase, AMpr -Amplicillin opposition in E.coli.Direction of written text is indicated by pointers with luc+ and AMpr cistron.

Three sets of experiments were performed to research the activity of allele IL13-1512A/C polymorphism and important consequence on IL-13 look. Murine Th2 were nucleofected concept such as HS6/luc ( consisting proximal booster part of IL-13 ) , HS4/luc-1512A and HS4 luc-1512C severally. HS6/luc was used as control. The consequences show 20 fold addition in the luciferase activity in cells transporting HS4-1512C/luc ( P=0.0003 ) ( Figure:4a ) when carried with HS4-1512A/luc ( p=0.0004 ) ( Figure:4a ) . In another two experiments, Th2 cells taken from murine and human Tcells were nucleofected with -2666IL-13A/luc and -2666IL-13C/luc severally. Approximately, an addition of 7 crease was observed in the newsman activity in human Th2 cells. These consequences illustrate that IL13-1512C allelomorph increases the activity of luciferase newsman and IL-13 look ( Kiesler.et.al.2009 ) .

“ Adapted from Kiesler p.et Al. ( 2009 ) Human Molecular Genetics 18,4513-4520 ”

IL13-1512C contact actions Hs4 dependent IL-13 look. A ) and C ) Transfection with HS4 luc concepts after the proliferation of Th2 murine cell. A-2666IL-13p/luc concept C. ) After station transfection, Harvesting of cells with -A or C at -1512 place was done. RLA is used to construe the consequences. D ) -2666IL13p/luc incorporating -A or C at -1512 places are nucleofection of Jurkat T cells and statistical values are used to show the consequences in fold initiation value.

Write down 3 major decision drawn by the writers about protein factors that bind differentially to the HS4 allelomorphs utilizing the electromobility displacement assay ( EMSA ) information presented in Figure 2. Make certain you explain where the informations back uping each decision are shown in the Figure.

The word pictures of molecular mechanism of IL-13-1512 allelomorphs, 3 decisions were drawn by writers utilizing EMSA analysis.

First, A particular composite which binds with HS4-1512 C ( lane 5-6 Fig 5a ) but non with HS4-1512A ( lane 1-2 Fig 5a ) . When oligonucleotide rival incorporating an octamer motive ( 5’GGATGCAAATATGCAAATATGCAAATGG3 ‘ ) was added in the experiment, composite did non look ( lane 2 Fig 5b ) but it appeared on add-on of disrupted oligonucleotide ( Lane 3 Fig 5b ) .

Second, from EMSA analysis it is besides suggested that Oct-1 has possibility to organize a direct composite with DNA as a consequence of interaction of recombinant Oct-1 with -1512C allelomorph and octamer investigation. ( lane 11, Fig 5b ) .

Third, IL13-1512C allelomorph was found to organize Oct-1 binding motive due to replacing of A with C in IL-13 booster. Specific binding of Oct-1 was confirmed by experiment with anti Oct-1 particular ( absences of Oct-1 lane 11 Fig 5a ) and command antibody IgG? ( presences of Oct-1 lane 12 Fig 5a ) .

“ Adapted from Kiesler p.et Al. ( 2009 ) Human Molecular Genetics 18,4513-4520 ”

EMSA exemplifying selective binding of Oct-1 after incubating with Th2 murine cells. A ) Th2 human cells B ) Details of experimental status and EMSA investigation are shown below the gel and rival and supershifting of antibodies that were added is denoted above the lane.

Describe the TaqMan check for quantitative PCR and explicate how it was used in this survey to show discriminatory binding of Oct-1 to the HS4 C-allele.

The TaqMan investigation was developed by using Biosystems named after a computing machine game called Pac Man which has similar rule to increase the specificity by replacing station elaboration measure with laser sensing in existent clip PCR check. The rule is based on 5′-3 ‘ exonuclease activity of DNA polymerase to split fluorescent dye labelled investigation. The TaqMan investigation comprises of two fluorescent tickets viz. reporter dye such as 6 carboxyfluorescein ( FAM ) attached to 5 ‘ terminal and quencher molecule e.g. 6-carboxy tetramethylrhodamine ( TAMARA ) attached to 3 ‘ terminal. ( Figure: 6 )

It helps in the debasement of the TaqMan investigation, by enzyme called Taq DNA polymerase which helps the newsman dye evading slaking activity of TAMARA. Hence fluorescent activity is relative to concluding PCR merchandise i.e. , fluorescent activity additions with addition in cleavage of investigation.

ABI prism 7900 monitors the place of 96 good micro titre home bases at 8 times per minute. Datas are stored in existent clip finding and at the terminal of 40 rhythms all informations are stored in SDS file for quantitative analysis. ( Leutenegger.2001 ) .

TaqMan SNP allelomorphic finding check and allelomorph specific chromatin immunoprecipitation was employed to show binding of Oct-1 and HS4 allelomorph. The chromatin isolated from peripheral blood CD4+ T cell heterozygous at IL-13 -1512A & gt ; C was crosslinked, sonicated and immunoprecipitated with anti Oct-1antibody or control IgG antibody. The quantification of sample was performed utilizing TaqMan assay that amplifies 68 bp polymorphous part of distal booster of homo ( -1517- 1479 ) TL13 and analyses the binding between HS4 and Oct-1 with two allelomorphs specific newsman investigations viz. VIC dye and FAM dye which identifies -1512A and -1512C alleles severally. The signal ratio of two newsman dye VIM/FAM was systematically equal to 1 over different orders of input DNA. The consequences were interpreted in footings of comparative transcript figure Internet Explorer, the ratio between the figure of HS4 mark immunoprecipitation with Oct-1 and with control IgG Ab severally. ( Fig 6a and Fig 6b )

Kiesler p.et Al. ( 2009 ) Human Molecular Genetics 18,4513-4520 ”

Allele specific enlisting of Oct -1 and HS4 allele. A ) Results of VIC: FAM signal B ) HS4 mark ration with antiOct-1 and command IgAb preformed in 3 different experiment.

Does Oct-1 binding to HS4 enhance or repress IL13 look? Explain your logical thinking.

HS4 nowadays in IL-13 distal booster Acts of the Apostless as cis-regulating component which regulates the IL-13 look. The enhanced activity of HS4 can be found upon binding of written text factor such as NF90 and NF45 ( NF-nuclear factor ) to 3 ‘ terminal of this component. ( Agarwal, S.et.al.2000 ) . Oct-1 is expressed everyplace in T lymph cell which triggered tissue specific cistron written text by interacting specifically with NFAT household protein within allergic ( HS ) site. ( Kym et.al.1997 ) .However, the IL-13-1512C allelomorphs of distal IL-13 booster creates a binding site for Oct-1 and endogenous degree of Oct-1 was dependent on enhance HS4 sites. Jointly, these consequences illustrate that Oct-1 adhering to HS4 enhances IL-13 look.

Explain the check the writer used to show that differential look of the HS4 A and C-alleles is sensitive to degrees of Oct-1 in the cell.

Polarization procedure was used to bring forth Th2 cells from C57B2/6 wild type or Oct+/1 heterozygous mice for 9-10 yearss.

CYTOKINE Staining

Th2 cell polarisation was so assessed by intercellular cytokine staining to find the form of cytokine look in differentiated CD+ Tcells in which IL-4, IL-13 and IFN- ? were stained intracellularly. ( Webster et.al. , 2006 ) .These coloring material coded beads are covalently attached to specific monoclonal antibodies against IL-13 and IL-4 ( taken as control ) in order to adhere with mice IL-13 in the sample. The conjugated beads are allowed to respond with a sample comprising of a known criterion or unknown sum of cytokines. After incubation, unbound cytokines are removed by rinsing, biotinylated sensing antibodies to different antigenic determinant on each cytokines are added to the reaction. After add-on of streptavidin phycoerthrin which has fluorescence belongings to separate from the beads. The concentration of cytokines of sample is detected by flow cytometry which measured fluorescent strength of conjugate which is straight relative to the degrees of IL 13 and IL4. The look degree of IL 13 and IL-4 are about the same in both Oct+/+ and Oct+/- as shown in figure 8 A and 8 B. After staining cytokines, from Oct+/+ and Oct +/- amice, Th2 cells are taken and subjected to nucleofection with Hs4/luc ( Fig. 8C ) holding A or C at -1512 site and 2666IL13p/Luc ( fig 8D ) concepts.

LUCIFERASE AND BCA ASSAY

Luciferase check was used to measure the luciferase activity in the cell and BCA ( Bicinchonic activity ) was used to gauge the entire protein concentration of the cell.

Luciferase check is used to catalyse a cheiluminiscent oxidization decrease reaction in the presence of luciferase: “ luciferase substrate ( luciferin ) + ATP + O2 > oxyluciferin + visible radiation ( 560 nanometer ) + AMP + PPi + CO2 ”

“ Adapted from stratagene ”

The emanation of visible radiation is the step of luciferase activity which is detected by luminometer. ( Stratagene protocols ) .Although, appraisal of the protein by BCA is based on rule of formation Cu2+ composite and decrease of Cu++ . Then the degree of protein in the sample is relative to decrease reaction. The comparative luciferase activity units ( RIA ) is used to show the sensitiveness of HS4-1512C and HS4-1512A to the degree of Oct-1. Relative Luciferase activity and entire protein content are assessed by luciferase and Bicinchoninic assay severally ( fig 8E and 8F ) .

HS4 -1512A/C allelomorphs increased look in the atomic environment to the degree of Oct-1. Immunofluorescence check showed look of il-13 ( A ) and IL-4 ( B ) ( taken as control ) on nucleofection of Th2 cells taken from Oct+/+ and Oct +/- mice with HS4/ luc concept ( degree Celsius ) and -2666Il13p/luc concept ( D ) . The transfection efficiency and entire protein content were expressed as comparative luciferase activity ( E and F ) . Less activity was observed in -1512A allelomorphs than -1512C allele towards the degree of Oct-1 in both wild type and mutated cells because -1512A did non octamer adhering motive ( mention ) . RLA consequences show that the cells were nucleofected with HS4/luc ( E ) and -2666IL13p/luc ( F ) .

Suggest one extra experiment that could hold been used to look into the influence of Oct-1 degrees in the cell on IL-13 look?

siRNA ( coding for oct1 ) mediated transfection of murine and Th2 cells utilizing the liposomesor miRNA ( coding for oct1 ) to look into the influence of oct 1 degree in the cells on IL13 look can be used. It is so transfection by utilizing GATEWAY recombination vector. In this vector, the cistron of involvement is amplified with attB tagged primer pair.The PCR which has attP site consequences in formation of ringers. The ensuing ringer has cistron of involvement. This vector has assorted advantages such as supports site directed mutagenesis and Mutiple cistron can be transfected. As the CD4+ and root cells are really hard totransduce with vectors. Lentiviral vectors can besides be used in this instance with TET ON/OFF system ( high degree of look ) incorporating oct1 concept. ( Yin.et.al.1996 ) . Fluorescent check can be used for protein detection/ look.

Summarize the significance of the HS4-1512C/A polymorphism in asthma/allergy sensitivity.

Previous findings emancipates that In asthma, the familial and environmental factor plays an indispensable function in the pathogenesis as it is considered to be familial and familial disease. H Li et.al, investigated kids of Chinese Han nationality for the development asthma. The research was carried out to happen the association between the individual and combined association between 8 SNP venue in 5 cistrons. Consequences suggest that Merely small part is made in development of asthma with 6 venues ( IL-13, IL-12T, IL-Bl1923T, IL-590T ) . Findingss show that bearer of both T/T or A/A are more to predisposited to asthma than either individual or no SNP. Hypersensitive site 4 ( HS4 ) Commonwealth of Independent States modulating element nowadays in the distal booster part of IL13 cistron HS4 site ( -1650 to-1435, enumeration is comparative to IL1ATG ) up regulates the IL13 looks and has a SNP of IL13-1512A/C which is linked with Ig E degrees. Cui et.a, cubic decimeter has every bit found a similar consequence and therefore confirms that homozygosity for -109T alleled associated with increased IgE degree in asthma. Association between IL-13 1512A & gt ; C in atopic asthma kids in Korea is being noticed and besides shows high IgE degrees. To sum-ups, researches done so far are exploited to happen the part of wheezing phenotype to clarify the cause of disease.

Bibliography

  1. Agarwal, S. , Avni, O. and Rao, A. ( 2000 ) Cell-type-restricted binding of the written text factor NFAT to a distal IL-4 foil in vivo. Immunity, 12, 643-652.Biol. , 24, 1022-1032.
  2. Cameron, L. , Webster, R.B. , Strempel, J.M. , Kiesler, P. , Kabesch, M. , Ramachandran, H. , Yu, L. , Stern, D.A. , Graves, P.E. , Lohman, I.C. ( 2006 ) Th2-selective sweetening of human IL13 written text by IL13-1112C.T, a polymorphism associated with allergic redness.
  3. Christian M. Leutenegger ( 2001 ) The Real-time TaqMan PCR and Applications in Veterinary Medicine Veterinary Sciences Tomorrow
  4. Cohn, L. , Homer, R. J. , Marinov, A. , Rankin, J. , & A ; Bottomly, K. ( 1997 ) . Initiation of airway mucous secretion production By T assistant 2 ( Th2 ) cells: a critical function for interleukin 4 in cell enlisting but non mucus production. J Exp Med 186, 1737-1747.
  5. Donata Vercelli ( 2008 ) Detecting susceptibleness cistrons for asthma and allergy Nature Reviews Immunology 8, 169-182
  6. Franklin J. Moy, Elizabeth Diblasio2, James Wilhelm and Robert Powers, Solution Structure of Human IL-13 and Implication for Receptor Binding J. Mol. Biol. ( 2001 ) 310, 219A±230
  7. Ghaffar O, Laberge S, Jacobson MR, et Al. ( 1997 ) IL-13 messenger RNA and immunoreactivity in allergen-induced coryza: comparing with IL-4 look and transition by topical glucocorticoid therapy. Am J Respir Cell Mol Biol ; 17:17A±24.
  8. GruE nig G, Warnock M, Wakil AE, et Al. ( 1998 ) Requirement for IL-13 independentlyof IL-4 in experimental asthma. Science ; 282:2261A±2263.
  9. Patricia Kiesler, Arvind Shakya, Dean Tantin and Donata vercelli. ( 2009 ) , Functional Characterization of an Allergy-Associated Regulatory J. Immunol. , 177, 8633-8642.in allergen-induced coryza: comparing with IL-4 look and transition by topical glucocorticoid therapy. Am J Respir Cell Mol Biol ; 17:17A±24.
  10. Killar, L. , MacDonald, G. , West, J. , Woods, A. , & A ; Bottomly, K. ( 1987 ) .Cloned Ia restricted T cells that do non bring forth IL4/BSF-1 fail to assist antigen specific B cells. J Immunol 138, 1674A± 1679.
  11. Kim, H.B. , Lee, Y.C. , Lee, S.Y. , Jung, J. , Jin, H.S. , Kim, J.H. , Kim, B.S. , Kang, M.J. , Jang, S.O. ,
  12. Kim, J. et Al. ( 2006 ) Gene-gene interaction between IL-13 and IL-13Ralpha1 is associated with entire IgE in Korean kids with atopic asthma. J. Hum. Genet. , 51, 1055-1062.
  13. Kotsimbos TC, Ghaffar O, Minshall EM, et Al ( 1998 ) . Expression of the IL-4 receptor alpha-subunit is increased in bronchial biopsy specimens from atopic and nonatopic wheezing topics. J Allergy Clin Immunol ; 102:859A±866.
  14. Kym N. Duncliffe, Andrew G. Bert, Mathew A. Vadas, and Peter N. Cockerill ( 1997 ) A T Cell-Specific Enhancer in the Interleukin-3. Locus Is Activated Hand in glove by Oct and NFAT Elements within a DNase I-Hypersensitive Site. Immunity, Vol. 6, 175-185
  15. Mosmann, T. R. , Cherwinski, H. , Bond, M. W. , Giedlin, M. A. , & A ; Coffman, R. L. ( 1986 ) . Two types of murine assistant T cell ringer: I. Definition harmonizing to profiles of lymphokine activities and secreted proteins. J Immunol 136, 2348A± 2357
  16. Schenborn, E. and Goiffon, V. ( 1991 ) Optimization of TransfectamA®-mediated transfection utilizing a luciferase newsman system. Promega Notes 33, 8-11.
  17. Strempel, J.M. and Vercelli, D. ( 2007 ) Functional dissection Identifies a CNS-1 nucleus that mediates IL13 and IL4 transcriptional sweetening. J. Biol. Chem. , 282, 3738-3746.
  18. Thomas A. Wynn ( 2003 ) IL-13 effecter maps, Annual Review of Immunology Vol.21:425-456
  19. Wang, V.E. , Schmidt, T. , Chen, J. , Sharp, P.A. and Tantin, D. ( 2004 ) Embryonic deadliness, decreased erythropoiesis, and faulty octamer-dependent booster activation in Oct-1-deficient mice. Mol. Cell.
  20. Webster, R.B. , Rodriguez, Y. , Klimecki, W.T. and Vercelli, D. ( 2007 ) .The human IL-13 venue in neonatal CD4? T cells is stubborn to the acquisition of a inhibitory chromatin architecture. J. Biol. Chem. , 282, 700-709.
  21. Wills-Karp M, Luyimbazi J, Xu X, ( 1998 ) Interleukin-13: Cardinal go-between of allergic asthma. Science ; 282:2258A±2261.
  22. Wills-Karp, M. , Luyimbazi, J. , Xu, X. , Schofield, B. , Neben, T. Y. , Karp, C. L. , ( 1998 ) . Interleukin-13: cardinal go-between of allergic asthma. Science 282, 2258- 2261.
  23. Yamashita, M. , Shinnakasu, R. , Nigo, Y. , Kimura, M. , Hasegawa, A. , Taniguchi, M. , ( 2004 ) . Interleukin ( IL ) -4-independent care of histone alteration of the IL-4 cistron venue in memory Th2 cells. J Biol Chem 279, 39454- 39464.
  24. Yin, D.X. , Zhu, L. & A ; Schimke, R.T ( 1996 ) Teracycline controlled cistron look system achieves high degree and quantitative control of cistron look
  25. Zhang, D. H. , Cohn, L. , Ray, P. , Bottomly, K. , & A ; Ray, A. ( 1997 ) .Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific look
  26. Zhang, D. H. , Yang, L. , Cohn, L. , Parkyn, L. , Homer, R. , Ray, P. ( 1999 ) . Inhibition of allergic redness in a murine theoretical account of asthma by look of a dominant-negative mutation of GATA-3. Immunity 11,473- 482.
  27. Zhu, Z. , Zheng, T. , Homer, R. J. , Kim, Y. K. , Chen, N. Y. , Cohn, L. , ( 2004 ) . Acidic mammalian chitinase in wheezing Th2 redness and IL-13 tract activation. Science 304, 1678- 1682.